View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_41 (Length: 287)
Name: NF0766_low_41
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 5 - 138
Target Start/End: Complemental strand, 31839678 - 31839545
Alignment:
Q |
5 |
attttgctttctttcttttcaattttcaaagtttaaagaatgataatatttatataaataagttctaataaaccaaatgaaaaatattagattttacttg |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31839678 |
attttgctttctttcttttcaattttcaaagtttaaagaatgataatatttatataaataagttctaataaaccaaatgaaaaatattagattttacttg |
31839579 |
T |
 |
Q |
105 |
ttttttcaaaaagcagaaaataatgtcattttat |
138 |
Q |
|
|
||||| ||||||||||||||||||| ||||||| |
|
|
T |
31839578 |
cttttttaaaaagcagaaaataatgttattttat |
31839545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4645 times since January 2019
Visitors: 4838