View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0766_low_42 (Length: 282)

Name: NF0766_low_42
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0766_low_42
NF0766_low_42
[»] chr3 (1 HSPs)
chr3 (12-253)||(14996518-14996759)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 253
Target Start/End: Original strand, 14996518 - 14996759
Alignment:
12 atgaaggttgattgattcacatcatgttgaaactccgctccgttgtcaatgtgcgacatttttagagttcagataatgtttaaccttgaagttcaaagga 111  Q
    ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||    
14996518 atgaaggttgattgattcacatcatgtcgaaactccgccccgttgtcaatgtgcgacatttttagagttcagatactgtttaaccttgaagtacaaagga 14996617  T
112 acggtttgtgtagtgatatttgctaattgtggtggtgtattgtaaagattaagagaaaggaagatatttttatgatttttctattgattggtttcaagga 211  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
14996618 acggtttgtgtagtgatatttgctaattgtggtggggtattgtaaagatgaagagaaaggaagatatttttatgatttttctattgattggtttcaagga 14996717  T
212 agaagagggagataaagtatttcattagtatgtagaagaaga 253  Q
    ||| ||||||||||||||||||||||||||||||| ||||||    
14996718 agaggagggagataaagtatttcattagtatgtagcagaaga 14996759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University