View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_42 (Length: 282)
Name: NF0766_low_42
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 253
Target Start/End: Original strand, 14996518 - 14996759
Alignment:
| Q |
12 |
atgaaggttgattgattcacatcatgttgaaactccgctccgttgtcaatgtgcgacatttttagagttcagataatgtttaaccttgaagttcaaagga |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
14996518 |
atgaaggttgattgattcacatcatgtcgaaactccgccccgttgtcaatgtgcgacatttttagagttcagatactgtttaaccttgaagtacaaagga |
14996617 |
T |
 |
| Q |
112 |
acggtttgtgtagtgatatttgctaattgtggtggtgtattgtaaagattaagagaaaggaagatatttttatgatttttctattgattggtttcaagga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14996618 |
acggtttgtgtagtgatatttgctaattgtggtggggtattgtaaagatgaagagaaaggaagatatttttatgatttttctattgattggtttcaagga |
14996717 |
T |
 |
| Q |
212 |
agaagagggagataaagtatttcattagtatgtagaagaaga |
253 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14996718 |
agaggagggagataaagtatttcattagtatgtagcagaaga |
14996759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University