View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_48 (Length: 275)
Name: NF0766_low_48
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_48 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 47 - 275
Target Start/End: Complemental strand, 653961 - 653733
Alignment:
Q |
47 |
agattacagactccttccacaacatcctcttcctgcagcgtatgaagatggttggacttctctccaatgggttgcttctcacacaagcaatgaccccaac |
146 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
653961 |
agattacagacttcttccacaacatcctcttcctgcagcgtatgaagatggttggacttctctccaatgggttgcttctcacacaagcaatgaccccaac |
653862 |
T |
 |
Q |
147 |
agtagcatagaaaaagaacaatggttacaagattctggtgatttcaacaaagtttacataggtggtgatgtcaacggtgctaaccttgctcataacttag |
246 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
653861 |
agtagcatagaaaaagaacaatggttacaagattatggtgatttcaacaaagtttacataggtggtgatgtcaacggtgctaaccttgctcataacttag |
653762 |
T |
 |
Q |
247 |
ctatgcgtgctggaactgaaacattacca |
275 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
653761 |
ctatgcgtgctggaactgaaacattacca |
653733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University