View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_54 (Length: 251)
Name: NF0766_low_54
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0766_low_54 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 653095 - 653331
Alignment:
| Q |
16 |
ataaacaccaaaacgaatcaaagtaaactcaatttgataaatggagccaagattacaaaagaaattgtttatttcccgacctcgtgttgaacttgtttgt |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
653095 |
ataaacaccaaaacgattcaaagtaaactcaatttgataaatggggccaagattacaaaagaaattgtttatttcccgacctcgtgttgaacttgtttgt |
653194 |
T |
|
| Q |
116 |
caactaaagaaatgagtttgatcaatcatttaataagctcaacaatatttcacaaacaactatggacnnnnnnnccctcacttacggaccaatacatttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
653195 |
caactaaagaaatgagtttgatcaatcatttaataagctcaacaatatttcataaacaactatggattttttttccctcacttacggaccaatacatttt |
653294 |
T |
|
| Q |
216 |
tctcttacatttattg-caagggttaatcaaacaaga |
251 |
Q |
| |
|
||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
653295 |
tctttaacatttattgaaaagggttaatcaaacaaga |
653331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5394 times since January 2019
Visitors: 4850