View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0766_low_55 (Length: 243)
Name: NF0766_low_55
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0766_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 29487688 - 29487475
Alignment:
Q |
1 |
cttgaagagtagagagtcaaatcaaaaataaggcgaacaatcacacatcacgtgcacaattcaacgcatctgcatgcgaacacgaaactaaattatagaa |
100 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||| || |
|
|
T |
29487688 |
cttgaagggtagagagtcaaatccaaaataaggcgaacaatcacacgtcacgtgcacaattcaacgcatcaacatacgaacacgaaactaaattataaaa |
29487589 |
T |
 |
Q |
101 |
aaagagtatcatcgtgacaaccgataaatcgtcccgtccaccacaactctctgcttcataacacccgaaaacacccagcaacatagaccctttcgagcca |
200 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
29487588 |
aaagagtatcatcgtgacaaccgataaatcgacccgtccaccacaactctctgcttcataacacccgaaaacacccagcaacatagaccctttcgagtca |
29487489 |
T |
 |
Q |
201 |
taacagttcgacca |
214 |
Q |
|
|
|||||||||||||| |
|
|
T |
29487488 |
taacagttcgacca |
29487475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University