View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0766_low_67 (Length: 222)

Name: NF0766_low_67
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0766_low_67
NF0766_low_67
[»] chr8 (1 HSPs)
chr8 (33-200)||(3958206-3958373)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 33 - 200
Target Start/End: Complemental strand, 3958373 - 3958206
Alignment:
33 aataatatcgatgttctaacttcgattcaactctcacatcaagaggactcttggcgtttgagttgggtgggtggtgtgcaatattatgttaagttggtgt 132  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
3958373 aataatatcgatgttccaacttcgattcaactctcacatcaagaggactcttggcgtttgagttgggtgggtggtgtgcaatattatgttaagttggcgt 3958274  T
133 atttgttattgtcagacaaatgtattcctaatccatctcattatgtggtcgagaatgagggaattcgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3958273 atttgttattgtcagacaaatgtattcctaatccatctcattatgtggtcgagaatgagggaattcgt 3958206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University