View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0766_low_71 (Length: 204)

Name: NF0766_low_71
Description: NF0766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0766_low_71
NF0766_low_71
[»] chr8 (1 HSPs)
chr8 (1-194)||(1092677-1092870)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 1092870 - 1092677
Alignment:
1 gtttgtgtttttcaccaccatgttgagagggagaaacaacaccagaatagaagtgtattatgactctaacaaagcatggaattactacctatagaattgg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
1092870 gtttgtgtttttcaccaccatgttgagagggagaaacaacaccagaatggaagtgtattatgactctaacaaagcatggaattactacctatagaattgg 1092771  T
101 acaggagagaacattaaaatagactgggcaaagaagaccaatgtattaaaattacacaaatagtaaagaaataaatgtgattgttttgtctctg 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1092770 acaggagagaacattaaaatagactgggcaaagaagaccaatgtattaaaattacacaaatagtaaagaaataaatgtgattgttttgtctctg 1092677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University