View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_high_25 (Length: 251)
Name: NF0767_high_25
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0767_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 44907993 - 44907769
Alignment:
Q |
1 |
cttgattgcagcaacaaattttgcaactgtgtgtggactctttctcttgtcttttttagcaagcttgagaatttctaatctgtgtttggctatggagatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44907993 |
cttgattgcagcaacaaattttgcaactgtgtgtggactctttctcttgtcttttttagcaagcttgagaatttctaatctgtgtttggctatggagatt |
44907894 |
T |
 |
Q |
101 |
cccatgctttggagaaactcatggttgaagtaaaacatgtcttcttcttcaagctcgttttgtgcaaagacaaggccatactcatatacaagagatggct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44907893 |
cccatgctttggagaaactcatggttgaagtaaaacatgtcttcttcttcaagctcgttttgtgcaaagacaaggccatactcatatacaagagatggct |
44907794 |
T |
 |
Q |
201 |
caagattggtttttgatagccatga |
225 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
44907793 |
caagattggtttttgatagccatga |
44907769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 60 - 131
Target Start/End: Original strand, 22537599 - 22537670
Alignment:
Q |
60 |
caagcttgagaatttctaatctgtgtttggctatggagattcccatgctttggagaaactcatggttgaagt |
131 |
Q |
|
|
|||| ||||||||||||| |||||||||||||| || |||||||||||||| |||||||| |||||||||| |
|
|
T |
22537599 |
caagattgagaatttctagcctgtgtttggctattgaaattcccatgctttgaagaaactcgtggttgaagt |
22537670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 50 - 222
Target Start/End: Original strand, 2051633 - 2051805
Alignment:
Q |
50 |
tcttttttagcaagcttgagaatttctaatctgtgtttggctatggagattcccatgctttggagaaactcatggttgaagtaaaacatgtcttcttctt |
149 |
Q |
|
|
|||||| | ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| || |
|
|
T |
2051633 |
tcttttcttgcaagtttgagaatttctagcctgtgtttggctatggagattcccatgctttggagaaattcatggttgaagtaaaccatgtcttcttgtt |
2051732 |
T |
 |
Q |
150 |
caagctcgttttgtgcaaagacaaggccatactcatatacaagagatggctcaagattggtttttgatagcca |
222 |
Q |
|
|
| ||||| || |||||||| || ||||||||||| ||||||||||| ||||| || |||||||| ||||| |
|
|
T |
2051733 |
ctagctcattgtgtgcaaaagtgagaccatactcatacacaagagatggatcaaggtttgtttttgaaagcca |
2051805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 65 - 133
Target Start/End: Complemental strand, 48069900 - 48069832
Alignment:
Q |
65 |
ttgagaatttctaatctgtgtttggctatggagattcccatgctttggagaaactcatggttgaagtaa |
133 |
Q |
|
|
|||||||| |||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
48069900 |
ttgagaatctctagtctgtgtttggctattgagattcccatgctttgtagaaactcatggttgaagtaa |
48069832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4098 times since January 2019
Visitors: 4827