View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_high_4 (Length: 500)
Name: NF0767_high_4
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 173 - 481
Target Start/End: Complemental strand, 2898133 - 2897825
Alignment:
| Q |
173 |
tgactaaattatttccttcttaattgttttttatttgtgtttgtgcctaaatatttttcacttcaggttgcgactatgtaagctttactcctaaaaatag |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2898133 |
tgactaaattatttccttcttaattgttttttatttgtgtttgtgcctaaatatttttcacgtcaggttgcgactatgtaaaatttactcctaaaaatag |
2898034 |
T |
 |
| Q |
273 |
tgtatgcaaggaaggttttaaatgagaagattttttggcttgaaccggatataccctccacctaactgtatagactaataatctcgagatatgtatgact |
372 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2898033 |
tgtatgcaaagaaggttttaaatgagaagattttttggcttgaaccgggtataccctccacgtaactgtatagattaataatctcgagatatgtatgact |
2897934 |
T |
 |
| Q |
373 |
ataattggtgacaaagcttgctaggatgagaaagtgttctatcattctatgtggtttatggttgaccggtgcttgaaaattggtcaaaatgttgatgttt |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2897933 |
ataattggtgacaaagcttgctaggatgagaaagtgttctatcattctatgtggtttatggttgaccggtgcttgaaaattggtcaaaatgttgatgttt |
2897834 |
T |
 |
| Q |
473 |
gatgatgtc |
481 |
Q |
| |
|
| ||||||| |
|
|
| T |
2897833 |
gttgatgtc |
2897825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 49 - 104
Target Start/End: Complemental strand, 2898259 - 2898204
Alignment:
| Q |
49 |
ctcatctttacaaagagtgattgccgaataatatagaaaatcttgatcacaaaccc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2898259 |
ctcatctttacaaagagtgattgccgaataatatagcaaatcttgatcacaaaccc |
2898204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University