View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_high_7 (Length: 456)
Name: NF0767_high_7
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0767_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 3e-89; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 96 - 269
Target Start/End: Original strand, 44564874 - 44565048
Alignment:
Q |
96 |
acttatgctttcacttagtttgaaaatgtttattcatgctgataatttt-ttgcatgtatgtttcagttttccttgctgtatatgggattcagcattacc |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44564874 |
acttatgctttcacttagtttgaaaatgtttattcatgctgataatttttttgcatgtatgtttcagttttccttgctgtatatgggattcagcattacc |
44564973 |
T |
 |
Q |
195 |
tctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagtagtc |
269 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44564974 |
tctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagtagtc |
44565048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 338 - 444
Target Start/End: Original strand, 44565117 - 44565223
Alignment:
Q |
338 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
437 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44565117 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
44565216 |
T |
 |
Q |
438 |
gggtctc |
444 |
Q |
|
|
||||||| |
|
|
T |
44565217 |
gggtctc |
44565223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 339 - 419
Target Start/End: Complemental strand, 36035975 - 36035895
Alignment:
Q |
339 |
tgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactaca |
419 |
Q |
|
|
|||||||||||||||| |||||||||||| |||| ||| ||| |||||| ||||||||||| |||||||||||||||||| |
|
|
T |
36035975 |
tgttatctgatgtgttagtggctataggaggaaattgctgcagtggtatcaactgtgctctttgtgtctggagtgactaca |
36035895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 176 - 265
Target Start/End: Complemental strand, 36036118 - 36036029
Alignment:
Q |
176 |
tatgggattcagcattacctctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagt |
265 |
Q |
|
|
||||| ||||||||||| | || ||| |||||||| ||||||| | |||||||||||| | |||||||||||||| ||||||||||||| |
|
|
T |
36036118 |
tatggtattcagcattatgtttctatattaggttcattgattcttattccacttgtcattgttcctgctatgggaggttctcatgtgagt |
36036029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4384 times since January 2019
Visitors: 4835