View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_10 (Length: 457)
Name: NF0767_low_10
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 2e-81; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 96 - 270
Target Start/End: Original strand, 44564874 - 44565048
Alignment:
| Q |
96 |
acttatgctttcacttagtttgaaaatgtttattcatgctgataannnnnnngcatgtatgtttcagttttccttgctgtatatgggattcagcattacc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44564874 |
acttatgctttcacttagtttgaaaatgtttattcatgctgataatttttttgcatgtatgtttcagttttccttgctgtatatgggattcagcattacc |
44564973 |
T |
|
| Q |
196 |
tctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagtagtc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44564974 |
tctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagtagtc |
44565048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 339 - 445
Target Start/End: Original strand, 44565117 - 44565223
Alignment:
| Q |
339 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44565117 |
ctgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactacactcctgcacactattttt |
44565216 |
T |
|
| Q |
439 |
gggtctc |
445 |
Q |
| |
|
||||||| |
|
|
| T |
44565217 |
gggtctc |
44565223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 340 - 420
Target Start/End: Complemental strand, 36035975 - 36035895
Alignment:
| Q |
340 |
tgttatctgatgtgttggtggctataggatgaaactgcagcaatggtatgtactgtgctcttagtgtctggagtgactaca |
420 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| ||| ||| |||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
36035975 |
tgttatctgatgtgttagtggctataggaggaaattgctgcagtggtatcaactgtgctctttgtgtctggagtgactaca |
36035895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 177 - 266
Target Start/End: Complemental strand, 36036118 - 36036029
Alignment:
| Q |
177 |
tatgggattcagcattacctctcgataataggttcactgattctcactccacttgtcatagctcctgctatgggagcttctcatgtgagt |
266 |
Q |
| |
|
||||| ||||||||||| | || ||| |||||||| ||||||| | |||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
36036118 |
tatggtattcagcattatgtttctatattaggttcattgattcttattccacttgtcattgttcctgctatgggaggttctcatgtgagt |
36036029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4102 times since January 2019
Visitors: 4827