View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_12 (Length: 451)
Name: NF0767_low_12
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 120 - 443
Target Start/End: Complemental strand, 402069 - 401746
Alignment:
| Q |
120 |
atggtgtgctgggaggctgctaacccaaacaattggtttctgtgtttgaagggtgttggaagaccnnnnnnnnctctctcaattgcttgaagccggctgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
402069 |
atggtgtgctgggaggctgctaacccaaacaattggtttctgtgtttgaagggtgttggaagaccaaaaaaaactctctcaattgcttgaagccggctgg |
401970 |
T |
|
| Q |
220 |
tttaactgggaataaaatcgagattgtatttatgagatgccagaataaatatttgctggttttcggagatttcattcaacgaaacattataggtctcaat |
319 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401969 |
tttaactgtggataaaatcgagattgtatttatgagatgccagaataaatatttgctggttttcggagatttcattcaacgaaacattataggtctcaat |
401870 |
T |
|
| Q |
320 |
cttcgaaccctttcaggtggaacaaacctctgaagtcttgccaatatagcgcctatggctatgggatgtggctgttgtgctggaatgggagagggctgtg |
419 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401869 |
cttcgaaccctttcagatggaacaaacctctgaagtcttgccaatatagcgcctatggctatgggatgtggctgttgtgctggaatgggagagggctgtg |
401770 |
T |
|
| Q |
420 |
atgtcctatattcagtttcatatc |
443 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
401769 |
atgtcctatattcagtttcatatc |
401746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4434 times since January 2019
Visitors: 4835