View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_17 (Length: 407)
Name: NF0767_low_17
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 59 - 390
Target Start/End: Complemental strand, 26349191 - 26348846
Alignment:
| Q |
59 |
acctttgctctttttctgcaaactagaannnnnnngctcaattctgtattgtgtttgagaaatagctgcccccctctcaagcacacacatgctgcaaatt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26349191 |
acctttgctctttttctgcaaactagaatttttttgctcaattctgtattgtgtttgagaaatagctgcccccctctcaagcacacacatgctgcaaatt |
26349092 |
T |
|
| Q |
159 |
taacgtcacactcccccaatgagtgatgaaattagtttccttgacaatatttgaaaaaattatatttttaaccaaaccagttggaatttttaagaagaat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26349091 |
taacgtcacactcccccaatgagtgatgaaattagtttccttgacaatatttgaaaaaattatatttttaaccaaaccagttggaatttttaagaagaat |
26348992 |
T |
|
| Q |
259 |
cccttttcccaaaaaattatagataacagaaatggtaagtagacacacaattttagacacaaatac--------------gacagtaattttggtgtgaa |
344 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26348991 |
cccttttcgcaacaaattatagataacagaaatgacaagtagacacacaattttagacacaaatacaacaccatgggtaaaacagtaattttggtgtgaa |
26348892 |
T |
|
| Q |
345 |
ctagaagggtaatttgataattctacccccttctctcccttttctc |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26348891 |
ctagaagggtaatttgataattctacccccttctttcccttttctc |
26348846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 42226045 - 42226088
Alignment:
| Q |
281 |
ataacagaaatggtaagtagacacacaattttagacacaaatac |
324 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
42226045 |
ataacagcaatgataactagacacacaattttagacacaaatac |
42226088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 360
Target Start/End: Complemental strand, 15074441 - 15074407
Alignment:
| Q |
326 |
acagtaattttggtgtgaactagaagggtaatttg |
360 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
15074441 |
acagtaattttggtgtgaactagaggggtaatttg |
15074407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 286 - 324
Target Start/End: Original strand, 17341024 - 17341062
Alignment:
| Q |
286 |
agaaatggtaagtagacacacaattttagacacaaatac |
324 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
17341024 |
agaaatgataagtagacacacaattttggacacaaatac |
17341062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 360
Target Start/End: Original strand, 38495362 - 38495396
Alignment:
| Q |
326 |
acagtaattttggtgtgaactagaagggtaatttg |
360 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
38495362 |
acagtaattttggtgtgaactagaggggtaatttg |
38495396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 286 - 324
Target Start/End: Complemental strand, 20809361 - 20809323
Alignment:
| Q |
286 |
agaaatggtaagtagacacacaattttagacacaaatac |
324 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
20809361 |
agaaatgataagtagacacacaattttggacacaaatac |
20809323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3970 times since January 2019
Visitors: 4825