View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_31 (Length: 284)
Name: NF0767_low_31
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 36 - 230
Target Start/End: Complemental strand, 29611136 - 29610942
Alignment:
| Q |
36 |
catctccaacaaaatgtctcgcgcaagcaatagctttgttcctgaagtactaattagatatatgaaagtgattttgataaagatgactatggatactaat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29611136 |
catctccaacaaaatgtctcgcgcaagcaatagctttgttcctgaagtactaattagatatatgaaagtgattttgataacgatgactatggatactaat |
29611037 |
T |
|
| Q |
136 |
tttctataaattgttgttaaaatatttaatttcataaccaatggcatctgcctacttatctcccagccaaaaatgggtagccctttggatgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
29611036 |
tttctataaattgttgttaaaatatttaatttcataaccaatggcatctgcctacttacctcccagccaaaaatgggtagccctttcgataatgt |
29610942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 29582894 - 29582946
Alignment:
| Q |
36 |
catctccaacaaaatgtctcgcgcaagcaatagctttgttcctgaagtactaa |
88 |
Q |
| |
|
||||||||||||||||| | || ||||||||| |||||||||||||||||||| |
|
|
| T |
29582894 |
catctccaacaaaatgtttggcacaagcaataactttgttcctgaagtactaa |
29582946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4084 times since January 2019
Visitors: 4827