View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_33 (Length: 276)
Name: NF0767_low_33
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 47 - 216
Target Start/End: Original strand, 54702850 - 54703019
Alignment:
| Q |
47 |
catcatcatcttcgtcctcgccaccatccacagatctacaaacagttcagatccgtcttttctgccgccaactgtcttctacgactaccaacgcctacgg |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54702850 |
catcatcatcttcgtcctcgccaccatccacagatctacaaacagtttagatccgtcttttctgccgcctactgtcttctacgactaccaacgcctacgg |
54702949 |
T |
|
| Q |
147 |
aactaacaaacagatcctccgttattatccctttctcacctactgtcatctctctgtcgccggccgctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54702950 |
aactaacaaacagatcctccgttattatccctttctcacctactgtcatctctctgtcgccgaccgctgc |
54703019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3108 times since January 2019
Visitors: 4805