View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_38 (Length: 265)
Name: NF0767_low_38
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0767_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 37073509 - 37073402
Alignment:
| Q |
1 |
aatctttgttatattattaatgcaacagagaacttgtataggactgtacc--nnnnnnngagagaggacttgcacaggaaattaggtgacttttaaggtg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37073509 |
aatctttgttatattattaatgcaacagagaacttgtataggactgtaccaaaaaaagagagagaggacttgcacaggaaattaggtgacttttaaggtg |
37073410 |
T |
 |
| Q |
99 |
cacaagtg |
106 |
Q |
| |
|
|||||||| |
|
|
| T |
37073409 |
cacaagtg |
37073402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University