View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_42 (Length: 254)
Name: NF0767_low_42
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0767_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 2408452 - 2408683
Alignment:
Q |
14 |
ggcttaggatttgtgggctttaattttctgtattttacaacttgagaaccagttgttgtcgacgtagatttttgtttcaaggtcataaagattatcaatc |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
T |
2408452 |
ggcttaggatttgtgggctttaattttctgtattttacaacttgagaaccagttgttgtcgatgtagatttctgtttcaaggtcataaagattatcaatc |
2408551 |
T |
 |
Q |
114 |
atgtaggtgggaagttaaaacaacatcactgagattctaaactaggccaaaccatatgtatttttccatcctcctgcttgcctcaaagaatgttctttcc |
213 |
Q |
|
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||| |
|
|
T |
2408552 |
aagtaggtgggaagttaaaacaacatcagtgagattctaaactaggccaaaccttatgtatttttccatcctcctgcttgctttcaagaatgttcttttt |
2408651 |
T |
 |
Q |
214 |
gaaaccgtcattgatggcactcacatctctgc |
245 |
Q |
|
|
| ||||||||||||||| || |||||||||| |
|
|
T |
2408652 |
ggaaccgtcattgatggtgcttacatctctgc |
2408683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University