View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0767_low_60 (Length: 221)
Name: NF0767_low_60
Description: NF0767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0767_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 43109556 - 43109445
Alignment:
Q |
1 |
catctttcaatttcttcaattgttcgcgcaggattcttcggaaatcattatcatccgatgaacatggatgtgaatcagactatgctgattgcacttctca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
43109556 |
catctttcaatttcttcaattgttcgcgcaggattcttcggaaatcattatcatccgatgaacaaggatgtgaatcagactatgctgattgcacttctca |
43109457 |
T |
 |
Q |
101 |
aaagcctatgat |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
43109456 |
aaagcctatgat |
43109445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 188 - 221
Target Start/End: Complemental strand, 43109536 - 43109503
Alignment:
Q |
188 |
tgttcgcgcatgattcttcggaaatcattatcat |
221 |
Q |
|
|
|||||||||| ||||||||||||||||||||||| |
|
|
T |
43109536 |
tgttcgcgcaggattcttcggaaatcattatcat |
43109503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4385 times since January 2019
Visitors: 4835