View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_high_29 (Length: 272)
Name: NF0768_high_29
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 6695731 - 6695492
Alignment:
Q |
8 |
ccaacaatatgactgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttgatccctttccatgt |
107 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
6695731 |
ccaacaatatgtctgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttggtccctttccatgt |
6695632 |
T |
 |
Q |
108 |
gtcaagttgttgaacttgtcctttccggtgg----ggtcatgctactcatagcattctctttatccnnnnnnnnntaatttccttcaaatgtgggcacat |
203 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
6695631 |
gtcaagttgttgaacttgtcctttccggtggggtcggtcatgctactcatagcattctctttatccaaaaaaaaataatttccttcaaatgtgggcacat |
6695532 |
T |
 |
Q |
204 |
tcataactaacctccacatcttgcagaagcaattgggatg |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6695531 |
tcataactaacctccacatcttgcagaagcaattgggatg |
6695492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4418 times since January 2019
Visitors: 4835