View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0768_high_32 (Length: 260)

Name: NF0768_high_32
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0768_high_32
NF0768_high_32
[»] chr5 (1 HSPs)
chr5 (33-244)||(8173931-8174146)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 33 - 244
Target Start/End: Complemental strand, 8174146 - 8173931
Alignment:
33 acatcatcatcatgtgagtttgtgtttcaattcattcattcattca----cagtttaaggatatggcttcagctttatcctctatcatcaaccaacctca 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||    
8174146 acatcatcatcatgtgagtttgtgtttcaattcattcattcattcattcacagtttaaggatatggcttcagctttatcctctatcatcaaccaacctca 8174047  T
129 cactgctcaacgccttaaacttcattctccatcttgtctcagattcttcagacacaaacactatgcttttctcccttctcccaaaccattttcatcttca 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
8174046 cactgctcaacgccttaaacttcattctccatcttgtctcagattcttcaaacacaaacactatgcttttctcccttctcccaaaccattttcatcttca 8173947  T
229 cgtccttttcatctca 244  Q
    |||||| |||||||||    
8173946 cgtcctcttcatctca 8173931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3759 times since January 2019
Visitors: 4819