View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_12 (Length: 459)
Name: NF0768_low_12
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_12 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 170 - 459
Target Start/End: Complemental strand, 45541847 - 45541558
Alignment:
| Q |
170 |
actaaatctactttgtaatgcacatgtatataatacaataaaaatggaagttggcttggcaaaagaccctacttgatgatcaccctgcgagtgctagtga |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541847 |
actaaatctactttgtaatgcacatgtatataatacaataaaaatggaagttggcttggcaaaagaccctacttgatgatcaccctgcgagtgctagtga |
45541748 |
T |
|
| Q |
270 |
caaaatgtacaacacgaaaaacagcttagccatctatttggaggtgcgtctgtgtttgacttttgtgtctgatcaacttcttctgttttttcattttgct |
369 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541747 |
caaaatgtacaacacgaaaagcagcttagccatctatttggaggtgcgtctgtgtttgacttttgtgtctgatcaacttcttctgttttttcattttgct |
45541648 |
T |
|
| Q |
370 |
ctgatttcatatttgctgtgttattctctccaatacccttggatgagacacttttatctccatctttcgatcttcaaaataatgaacaca |
459 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541647 |
ctgatttcatatttggtgtgttattctctccaacacccttggatgagacacttttatctccatctttcgatcttcaaaataatgaacaca |
45541558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 32 - 143
Target Start/End: Complemental strand, 45542182 - 45542072
Alignment:
| Q |
32 |
atttcatcttatgtccttttttgtgatnnnnnnntattatatataaaatcctctcttcaaaacttgtacattgttttatgtgggcagctaaataagatac |
131 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
45542182 |
atttcatcttatgtccttttttgtgataacaaaatattatatataaaatcttctcttcaaaacttgt-cattgttttttgtgggcagctaaataagatac |
45542084 |
T |
|
| Q |
132 |
gttttatttgct |
143 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
45542083 |
gttttagttgct |
45542072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Complemental strand, 45541986 - 45541952
Alignment:
| Q |
137 |
atttgctaacatgttgaaagtacaattactctaac |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541986 |
atttgctaacatgttgaaagtacaattactctaac |
45541952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4152 times since January 2019
Visitors: 4827