View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_22 (Length: 381)
Name: NF0768_low_22
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 67 - 245
Target Start/End: Original strand, 8930887 - 8931065
Alignment:
| Q |
67 |
gaacctgtggcaaatatgtgaatgagtttattacgaataaactaacagataaaatttaaagtttactagtttaaaagtgaatagttgaaccaattatatt |
166 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8930887 |
gaacctgtgacaaatatgtgaatgagtttattacgattaaactaacagataaaatttaaagtttactagtttaaaagtaaatagttgaaccaattatatt |
8930986 |
T |
|
| Q |
167 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgtacaccccatggcaagattctaaacccatcctcg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8930987 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgtacaccccatggcaagattctaaacccttcctcg |
8931065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4161 times since January 2019
Visitors: 4829