View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_36 (Length: 332)
Name: NF0768_low_36
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 14 - 303
Target Start/End: Original strand, 33431588 - 33431877
Alignment:
| Q |
14 |
atatatgttaatcttatgtattagttaaacatttacacggtaaaagaagaataatatataaacagataagtatacaggaggtacttcaacccgatacaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33431588 |
atatatgttaatcttatgtattagttaaatgtttacacggtaaaaggagaataatatacaaacagataggtatacaagaggtacttcaacccgatacaat |
33431687 |
T |
 |
| Q |
114 |
gtgaaaactaacacatgtaatctttcnnnnnnnnnnnnnnnnnnnnnntaggagttattatagtctttaacgcgtgattatatctagagagaaattatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33431688 |
gtgaaaactaacacatgtaatctttcattttaattttttatttatttataggagttattatagtctttaacgcgtgattatatctaaagagaaattatat |
33431787 |
T |
 |
| Q |
214 |
atagtctctctcacatgactcaagaaaaataattgaagtattgagagagataaagatcatatagaatctaggcgtatatttataacttaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33431788 |
atagtctctctcacatgactcaagaaaaataattgaagtattgagagagataaagatcatatagaatctaggcgtatatttataacttaa |
33431877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University