View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_45 (Length: 296)
Name: NF0768_low_45
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 7 - 146
Target Start/End: Complemental strand, 27540691 - 27540552
Alignment:
Q |
7 |
ggagcagagattttaggaatattcaagtgtacgcagactcatagattacaattaagttgcagactgtctcaccaaatatgggctgaatttggacgctaag |
106 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
27540691 |
ggagtagagattttaggaatattcaagtgtacgcagactcatagattacaattaagttgcagattgtctcaccaaatatgggctgaatttggacgctaag |
27540592 |
T |
 |
Q |
107 |
ttcatgatttttgagttttttcctgccactttgtcaaatg |
146 |
Q |
|
|
|| |||||||||||||||| |||||||||||||||||||| |
|
|
T |
27540591 |
tttatgatttttgagttttctcctgccactttgtcaaatg |
27540552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 201 - 267
Target Start/End: Complemental strand, 27540497 - 27540431
Alignment:
Q |
201 |
gtctaagacgtagccaattttatttataaaataaaaaggataaacactcgtcttaaatgatagatag |
267 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
27540497 |
gtctaagacgtagccaattttattcataaaataaaaaagataaacactcgtcttaaatgatagatag |
27540431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 65
Target Start/End: Original strand, 11252056 - 11252116
Alignment:
Q |
7 |
ggagcagagattttaggaatattcaagtgtacgcagact--catagattacaattaagttg |
65 |
Q |
|
|
|||| |||| ||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
T |
11252056 |
ggagtagaggttttaggaatattcaagtgtacgcagacttaaaaagattacaattaagttg |
11252116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5603 times since January 2019
Visitors: 4857