View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_49 (Length: 281)
Name: NF0768_low_49
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 52 - 259
Target Start/End: Complemental strand, 46473449 - 46473251
Alignment:
| Q |
52 |
gcaacaatattcatcaattatgttgtgtttcctggagtcgctagaaatcgttgtccaccactttaaagatgtcaatgttgtgcaagcccttttgccaagt |
151 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46473449 |
gcaacaatattcaccaattatgttgtgtttcct---------agaaatcgttgtccaccactttaaagatgtcaatgttgtgcaagcccttttgccaagt |
46473359 |
T |
 |
| Q |
152 |
tgtccagcaatcagcattaataactttgagagtttatggttctgccgaatattcgaaaatgctagttcctcattctaaagtcaaaatggcagtagtgtgt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46473358 |
tgtccagcaatcagcattaataactttgagagtttatggttctgccgaatattcgaaaatgctagttcctcattctaaagtcaaaatggcagtagtgtgt |
46473259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University