View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_52 (Length: 278)
Name: NF0768_low_52
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 36388338 - 36388096
Alignment:
Q |
12 |
ataggtagacacccatctttccatttaatacctaatgtgctcccacatgtctctccatagtccaaaatggaatatgagtagaaataagagcgaaagttta |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
36388338 |
ataggtagacacccatctttccatttaatacctaatgtgctcccacatgtctctccatagtccaaaatggaatatgagtagaaataagagagaaagttta |
36388239 |
T |
 |
Q |
112 |
catccaatcaagcttt----catatgaatgttaattggatgtacaaaaattaaaggatgtttatcaatcttcactctatcctatatagcatattcaccaa |
207 |
Q |
|
|
||||||||||| |||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
36388238 |
catccaatcaacctttgactcatatgaatgttaattagatgtacataaattaaaggatgtttatcaatcttcactctatcctagatagcatattcaccaa |
36388139 |
T |
 |
Q |
208 |
gtaattaaggttttgaaacttcagatttttatgggcatatgtt |
250 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
36388138 |
gtaattaaggttttaaaacttcagatttttatgggcatatgtt |
36388096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University