View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0768_low_52 (Length: 278)

Name: NF0768_low_52
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0768_low_52
NF0768_low_52
[»] chr5 (1 HSPs)
chr5 (12-250)||(36388096-36388338)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 36388338 - 36388096
Alignment:
12 ataggtagacacccatctttccatttaatacctaatgtgctcccacatgtctctccatagtccaaaatggaatatgagtagaaataagagcgaaagttta 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
36388338 ataggtagacacccatctttccatttaatacctaatgtgctcccacatgtctctccatagtccaaaatggaatatgagtagaaataagagagaaagttta 36388239  T
112 catccaatcaagcttt----catatgaatgttaattggatgtacaaaaattaaaggatgtttatcaatcttcactctatcctatatagcatattcaccaa 207  Q
    ||||||||||| ||||    |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
36388238 catccaatcaacctttgactcatatgaatgttaattagatgtacataaattaaaggatgtttatcaatcttcactctatcctagatagcatattcaccaa 36388139  T
208 gtaattaaggttttgaaacttcagatttttatgggcatatgtt 250  Q
    |||||||||||||| ||||||||||||||||||||||||||||    
36388138 gtaattaaggttttaaaacttcagatttttatgggcatatgtt 36388096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University