View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0768_low_56 (Length: 272)

Name: NF0768_low_56
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0768_low_56
NF0768_low_56
[»] chr1 (1 HSPs)
chr1 (8-243)||(6695492-6695731)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 6695731 - 6695492
Alignment:
8 ccaacaatatgactgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttgatccctttccatgt 107  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
6695731 ccaacaatatgtctgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttggtccctttccatgt 6695632  T
108 gtcaagttgttgaacttgtcctttccggtgg----ggtcatgctactcatagcattctctttatccnnnnnnnnntaatttccttcaaatgtgggcacat 203  Q
    |||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||         |||||||||||||||||||||||||    
6695631 gtcaagttgttgaacttgtcctttccggtggggtcggtcatgctactcatagcattctctttatccaaaaaaaaataatttccttcaaatgtgggcacat 6695532  T
204 tcataactaacctccacatcttgcagaagcaattgggatg 243  Q
    ||||||||||||||||||||||||||||||||||||||||    
6695531 tcataactaacctccacatcttgcagaagcaattgggatg 6695492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5611 times since January 2019
Visitors: 4857