View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_57 (Length: 272)
Name: NF0768_low_57
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 243
Target Start/End: Complemental strand, 6695726 - 6695492
Alignment:
Q |
13 |
aatatgtctgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttgatccctttccatgtgtcaa |
112 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
6695726 |
aatatgtctgaatgcattatgtagaaacatacgaggtcagtttgcatccccacaccatgtgtaccacccattttgaatttggtccctttccatgtgtcaa |
6695627 |
T |
 |
Q |
113 |
gttgttgaacttgtcctttccggtgg----ggtcatgctactcatagcattctctttatccnnnnnnnnntaatttccttcaaatgtgggcacattcata |
208 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
6695626 |
gttgttgaacttgtcctttccggtggggtcggtcatgctactcatagcattctctttatccaaaaaaaaataatttccttcaaatgtgggcacattcata |
6695527 |
T |
 |
Q |
209 |
actaacctccacatcttgcagaagcaattgggatg |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
6695526 |
actaacctccacatcttgcagaagcaattgggatg |
6695492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University