View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_59 (Length: 267)
Name: NF0768_low_59
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 84
Target Start/End: Complemental strand, 26469108 - 26469036
Alignment:
| Q |
12 |
agctgttgctatgagtggactcgttgggttcttgcgtcagctcggtgacctcgctcagtcagttccctccctc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26469108 |
agctgttgctatgagtggactcgttgggttcttgcgtcagctcggtgacctcgctcagtcagttccctccctc |
26469036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 12 - 84
Target Start/End: Complemental strand, 26545480 - 26545408
Alignment:
| Q |
12 |
agctgttgctatgagtggactcgttgggttcttgcgtcagctcggtgacctcgctcagtcagttccctccctc |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26545480 |
agctgttgctatgagtggactcgttgggttcttgcgtcagctcggtgacctcgctcagtcagttccctccctc |
26545408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 167
Target Start/End: Complemental strand, 26469012 - 26468955
Alignment:
| Q |
110 |
aactgtttttgttcttgcttgatggtgaattgtgttcatagtttgttattgcattgag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26469012 |
aactgtttttgttcttgcttgatggtgaattgtgttcatagtttgttattgcattgag |
26468955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 167
Target Start/End: Complemental strand, 26545384 - 26545327
Alignment:
| Q |
110 |
aactgtttttgttcttgcttgatggtgaattgtgttcatagtttgttattgcattgag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26545384 |
aactgtttttgttcttgcttgatggtgaattgtgttcatagtttgttattgcattgag |
26545327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3207 times since January 2019
Visitors: 4808