View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_60 (Length: 260)
Name: NF0768_low_60
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 33 - 244
Target Start/End: Complemental strand, 8174146 - 8173931
Alignment:
Q |
33 |
acatcatcatcatgtgagtttgtgtttcaattcattcattcattca----cagtttaaggatatggcttcagctttatcctctatcatcaaccaacctca |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8174146 |
acatcatcatcatgtgagtttgtgtttcaattcattcattcattcattcacagtttaaggatatggcttcagctttatcctctatcatcaaccaacctca |
8174047 |
T |
 |
Q |
129 |
cactgctcaacgccttaaacttcattctccatcttgtctcagattcttcagacacaaacactatgcttttctcccttctcccaaaccattttcatcttca |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8174046 |
cactgctcaacgccttaaacttcattctccatcttgtctcagattcttcaaacacaaacactatgcttttctcccttctcccaaaccattttcatcttca |
8173947 |
T |
 |
Q |
229 |
cgtccttttcatctca |
244 |
Q |
|
|
|||||| ||||||||| |
|
|
T |
8173946 |
cgtcctcttcatctca |
8173931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University