View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_62 (Length: 254)
Name: NF0768_low_62
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_62 |
 |  |
|
| [»] scaffold0050 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 106 - 173
Target Start/End: Original strand, 1954 - 2021
Alignment:
| Q |
106 |
atcttggaatggaatgaaatcatcttcagctactgtgcatataaggattatgcagtttccctctctgc |
173 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1954 |
atcttggaatggaattaaatcatcttcagctactgtgcatataaggattatgcggtttccctctctgc |
2021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 1849 - 1887
Alignment:
| Q |
1 |
tgtcctttactaaggatatcatcagaactaaacttggta |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1849 |
tgtcctttactaaggatatcatcagaactaaacttggta |
1887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University