View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_63 (Length: 253)
Name: NF0768_low_63
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_63 |
 |  |
|
[»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 1873 - 1732
Alignment:
Q |
1 |
ctgatgatatccttagtaaaggacaaaaagtgaaactgaatgatttaagcataacaggtacccccgacaacctcaactcgtactcgatttgaagcacttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1873 |
ctgatgatatccttagtaaaggacaaaaagtgaaactgaatgatttaagcataacaggtacccccgacaacctcaactcgtactcgatttgaagcacttt |
1774 |
T |
 |
Q |
101 |
cagcaaagcaagacgttgctcaatcaaacattcaggagacag |
142 |
Q |
|
|
|| | ||||||||| || |||||||||||||||||||||||| |
|
|
T |
1773 |
caacgaagcaagacatttctcaatcaaacattcaggagacag |
1732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University