View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_64 (Length: 252)
Name: NF0768_low_64
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 3524539 - 3524357
Alignment:
| Q |
1 |
tagcaactctagacttcaaatat--gaataagagggtcttactaaagaggaggtcttaggtttgnnnnnnnntcggatctttggttgcttttgaagagta |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3524539 |
tagcaactctagacttcaaatatatgaataagagggtcttactaaagaggaggtcttaggtttgaaaaaaaatcggatctttggttgcttttgaagagta |
3524440 |
T |
|
| Q |
99 |
aacatagtattatgtaccaaagagggagggtgaagtggttcaacgagggtgactctaacttgactttctttcatgcttgcatc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524439 |
aacatagtattatgtaccaaagagggagggtgaagtggttcaacgagggtgactctaacttgactttctttcatgcttgcatc |
3524357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 3523129 - 3523081
Alignment:
| Q |
195 |
catcaaaaactagttcggttctcaaatcagaaggttcatgacttcatct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3523129 |
catcaaaaactagttcggttctcaaatcagaaggttcatgacttcatct |
3523081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5473 times since January 2019
Visitors: 4854