View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_65 (Length: 251)
Name: NF0768_low_65
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 24506673 - 24506881
Alignment:
Q |
18 |
aagacctacttgttcatacatttgacattgagaaatgagaacatcagcgacatcctcggtcgattcatcaatgtctaaagggaaattatttccttcgttt |
117 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
24506673 |
aagacctacttgttcataaatttgacattgagaaatgagaacatcagcgacatcctcagtcgattcatcaatgtctaaagggaaattacttccttcgttt |
24506772 |
T |
 |
Q |
118 |
tggtagagatgttcgttcggacagctgcattgctaaaacttggtcgtccccaacgaaatacttgttttgatcttcctatgcgatctcttgaacaagagaa |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
T |
24506773 |
tggtagagatgttcgttcggacagctgcattgctaaaacttggtcgtccccaacgaaatacttgttttgatctttctattcgatctcttgaacaagagaa |
24506872 |
T |
 |
Q |
218 |
tagtgtgat |
226 |
Q |
|
|
||||||||| |
|
|
T |
24506873 |
tagtgtgat |
24506881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University