View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_66 (Length: 251)
Name: NF0768_low_66
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_66 |
 | |
|
| [»] scaffold0552 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 6810756 - 6810975
Alignment:
| Q |
4 |
ttgtattttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgccgaacctcggatttgattgttattccagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6810756 |
ttgtattttcaataaattatgctaattcaacacggtgtcttcaagaattggagaaaataaccgaatgttgccgaacctcggatttgattgctattccagt |
6810855 |
T |
|
| Q |
104 |
gtattatgatggtgt-gtatccctccaatggaggcttgaagagtggtatgtttggagatgctttttatgattttgtggatagaatcagtatagaagaaga |
202 |
Q |
| |
|
|| ||||||||||| |||||||| || ||||| |||||||| ||||||||||||| || ||| ||||||||||||| |||||||||| ||| ||||| |
|
|
| T |
6810856 |
gttctatgatggtgtcttatccctcaaacggaggtttgaagagaggtatgtttggaggggcctttcatgattttgtggaaagaatcagtaaagatgaaga |
6810955 |
T |
|
| Q |
203 |
caagttcataggttgggtgg |
222 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
6810956 |
caagttcatgggttgggtgg |
6810975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 6506736 - 6506662
Alignment:
| Q |
1 |
taattgtattttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgcc |
75 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6506736 |
taattgtattttcaaagaattattttaattcaagatggtgtcttcaagaattggagaaaataacccagtgttgcc |
6506662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 6646178 - 6646257
Alignment:
| Q |
1 |
taattgtattttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgccgaacc |
80 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||| || ||||||||||||||| ||||| |||||||| ||||||| |||| |
|
|
| T |
6646178 |
taatagtattttcaagaaattatgttaattcaagatcgtgtcttcaagaatttgagaagataaccgagtgttgcctaacc |
6646257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 75
Target Start/End: Complemental strand, 6503223 - 6503155
Alignment:
| Q |
7 |
tattttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgcc |
75 |
Q |
| |
|
||||||||| |||||| |||| |||| ||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6503223 |
tattttcaaagaattatactaaatcaagatggtgtcttcaagaattggagaaaataacccagtgttgcc |
6503155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 126
Target Start/End: Original strand, 6830075 - 6830163
Alignment:
| Q |
38 |
gtgtcttcaagaattggagaaaataaccgaatgttgccgaacctcggatttgattgttattccagtgtattatgatggtgtgtatccct |
126 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| |||||||| || ||| ||||| |||| |||| | ||||||||| ||||||| |
|
|
| T |
6830075 |
gtgtgttcaagaattggagaaaataactgaatgttgtcgaacctcagacttggttgtttttcctgtgttctttgatggtgtctatccct |
6830163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 6594083 - 6593997
Alignment:
| Q |
9 |
ttttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgccgaacctcggatttgattgtt |
95 |
Q |
| |
|
||||||| ||||||| ||||||||| | |||| | |||||||||||||||||||| | |||||||||||||| |||||| ||||| |
|
|
| T |
6594083 |
ttttcaaaaaattatactaattcaagttcgtgtatacaagaattggagaaaataactcagtgttgccgaacctcagatttggttgtt |
6593997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 6737634 - 6737695
Alignment:
| Q |
18 |
aattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgccgaac |
79 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||||||||||||||||| || |||| |||||| |
|
|
| T |
6737634 |
aattatactaattctagatggtgtcttcaagaattggagaaaataactgagtgttaccgaac |
6737695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 6551439 - 6551367
Alignment:
| Q |
7 |
tattttcaataaattatgctaattcaacatggtgtcttcaagaattggagaaaataaccgaatgttgccgaac |
79 |
Q |
| |
|
||||||||| |||||| |||||| ||| | | ||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
6551439 |
tattttcaagaaattaggctaatacaagacgatgtctacaagaattgaagaaaataactgaatgttgccgaac |
6551367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 6543129 - 6543084
Alignment:
| Q |
35 |
atggtgtcttcaagaattggagaaaataaccgaatgttgccgaacc |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| ||||||| |
|
|
| T |
6543129 |
atggtgtcttcaagaattggagaaaataacccagtgttaccgaacc |
6543084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 75
Target Start/End: Complemental strand, 6523924 - 6523885
Alignment:
| Q |
36 |
tggtgtcttcaagaattggagaaaataaccgaatgttgcc |
75 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6523924 |
tggtgtcttcaagaattcgagaaaataaccgagtgttgcc |
6523885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0552 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0552
Description:
Target: scaffold0552; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 126
Target Start/End: Original strand, 9576 - 9664
Alignment:
| Q |
38 |
gtgtcttcaagaattggagaaaataaccgaatgttgccgaacctcggatttgattgttattccagtgtattatgatggtgtgtatccct |
126 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| |||||||| || ||| ||||| |||| |||| | ||||||||| ||||||| |
|
|
| T |
9576 |
gtgtgttcaagaattggagaaaataactgaatgttgtcgaacctcagacttggttgtttttcctgtgttctttgatggtgtctatccct |
9664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5103 times since January 2019
Visitors: 4845