View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_73 (Length: 239)
Name: NF0768_low_73
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 25 - 147
Target Start/End: Original strand, 9081642 - 9081764
Alignment:
| Q |
25 |
acacacattgatacctcttcatcaatcaagaccatatctatactaagcagttcatttttcttattgatatggaaattatcccatagtctagcaatgtgca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||| |
|
|
| T |
9081642 |
acacacattgatacctcttcatcaatcaagaccatatctatactaagcagttcatttttcttattgatatggaaattgtcccatagtctagaaatgcgca |
9081741 |
T |
|
| Q |
125 |
cttttagactactctcctctgtg |
147 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
9081742 |
cttttagactactctcccctgtg |
9081764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 32665500 - 32665398
Alignment:
| Q |
19 |
aatataacacac--attgatacctcttcatcaatcaagaccatatctatactaagcagttcatttttcttattgatatggaaattatcccatagtctagc |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32665500 |
aatataacacacgcattgatacctcttcatcaatcaagaccatatctatactaagcagttca-ttttcttattgatatggaaattgtcccatagtctagc |
32665402 |
T |
|
| Q |
117 |
aatg |
120 |
Q |
| |
|
|||| |
|
|
| T |
32665401 |
aatg |
32665398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 79 - 147
Target Start/End: Complemental strand, 27597642 - 27597574
Alignment:
| Q |
79 |
tttttcttattgatatggaaattatcccatagtctagcaatgtgcacttttagactactctcctctgtg |
147 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
27597642 |
ttttttttattgatgtggaaattgtcccatagtctagcaatgcatacttttacactactctcctctgtg |
27597574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 6412924 - 6412979
Alignment:
| Q |
19 |
aatataacacac--attgatacctcttcatcaatcaagaccatatctatactaagc |
72 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412924 |
aatataacacacgcattgatgcctcttcatcaatcaagaccatatctatactaagc |
6412979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2917 times since January 2019
Visitors: 4805