View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_74 (Length: 228)
Name: NF0768_low_74
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0768_low_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 6062711 - 6062590
Alignment:
Q |
1 |
tcggatcaagaataagaatgttgtgtatgtgagaaactattttggtatcgagaatgatcttacggcggaggaagaggcggcgattcggtttaagaatagt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6062711 |
tcggatcaagaataagaatgttgtgtatgtgagaaactattttggtatcgagaatgatcttacggcggaggaagaggcggcgattcgttttaagaatagt |
6062612 |
T |
 |
Q |
101 |
tggacttttgacggggctgaag |
122 |
Q |
|
|
||||||||||| || ||||||| |
|
|
T |
6062611 |
tggacttttgatggtgctgaag |
6062590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3225 times since January 2019
Visitors: 4808