View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0768_low_74 (Length: 228)

Name: NF0768_low_74
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0768_low_74
NF0768_low_74
[»] chr2 (1 HSPs)
chr2 (1-122)||(6062590-6062711)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 6062711 - 6062590
Alignment:
1 tcggatcaagaataagaatgttgtgtatgtgagaaactattttggtatcgagaatgatcttacggcggaggaagaggcggcgattcggtttaagaatagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
6062711 tcggatcaagaataagaatgttgtgtatgtgagaaactattttggtatcgagaatgatcttacggcggaggaagaggcggcgattcgttttaagaatagt 6062612  T
101 tggacttttgacggggctgaag 122  Q
    ||||||||||| || |||||||    
6062611 tggacttttgatggtgctgaag 6062590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University