View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0768_low_75 (Length: 217)
Name: NF0768_low_75
Description: NF0768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0768_low_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 31410753 - 31410566
Alignment:
| Q |
1 |
cagttttcccattgtggaaccggatcctggtcatacaaaactccgtctttcaagagaaggtttagaggctattgagagaataacaaaccccattgcatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31410753 |
cagttttcccattgtggaaccggatcctggtcatacaaaactccgtctttcaagagaaggtttggaggctattgagagaattacaaaccccattgcatct |
31410654 |
T |
|
| Q |
101 |
gttgcagtatgtttgactgtaactttaaggcatacattgtctataacttttgattttactttattttaacatgaattttcgcaaactt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31410653 |
gttgcagtatgtttgactgtaactttaaagcatacattgtctataacttttcattttactttattttaacatgaattttcgcaaactt |
31410566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 38490557 - 38490676
Alignment:
| Q |
5 |
tttcccattgtggaaccggatcctggtcatacaaaactccgtctttcaagagaaggtttagaggctattgagagaataacaaaccccattgcatctgttg |
104 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| ||||| ||| || || || |||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
38490557 |
tttcccattgtcgaacctgatcctggtcatacaaaacttcgtctatcacaggacggcttggaggctatcgagagaataacaaaccccattgcatctgtgg |
38490656 |
T |
|
| Q |
105 |
cagtatgtttgactgtaact |
124 |
Q |
| |
|
||||| ||||||||| |||| |
|
|
| T |
38490657 |
cagtaagtttgactgcaact |
38490676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5824 times since January 2019
Visitors: 4859