View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0769_high_24 (Length: 251)

Name: NF0769_high_24
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0769_high_24
NF0769_high_24
[»] chr2 (1 HSPs)
chr2 (1-161)||(34672325-34672485)


Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 34672485 - 34672325
Alignment:
1 aggattttgagggatgcatgatatatggtagtgtttgcattgataatgagtatgaaatgggattgatgtaaatttggttttggtgtgtgcatgtatgcat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34672485 aggattttgagggatgcatgatatatggtagtgtttgcattgataatgagtatgaaatgggattgatgtaaatttggttttggtgtgtgcatgtatgcat 34672386  T
101 gatgatggattggaaattttggtagattgtgaatgaattgtgtaaagataggatgatgatg 161  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34672385 gatgatggattggaaattttggtagattgtgaatgaattgtgtaaagataggatgatgatg 34672325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5063 times since January 2019
Visitors: 4845