View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_high_27 (Length: 227)
Name: NF0769_high_27
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0769_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44048704 - 44048482
Alignment:
Q |
1 |
ttaaaaataaaaagattgtagcccaagattattaatcaatgaagagtgggaatttatttaagagggttggacatttgtcacaatcatgcaatttggacta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44048704 |
ttaaaaataaaaagattgtagcccaagattattaatcaatgaagagtgggaatttatttaagagggttggacatttgtcacaatcatgcaatttggacta |
44048605 |
T |
 |
Q |
101 |
tcggattaaaattggacgattaacattttactttatactttggatttaaaataacaaactcgaacctaaacttgaaactcttgatcatacaatctgaatt |
200 |
Q |
|
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44048604 |
tcggattaaaattggacgattcacattttactttgtactttggatttaaaataacaaactcgaacctaaacttgaaactcttgatcatacaatctgaatt |
44048505 |
T |
 |
Q |
201 |
gcttgaatgtatattcttcgaca |
223 |
Q |
|
|
||||||||||||||| ||||||| |
|
|
T |
44048504 |
gcttgaatgtatatttttcgaca |
44048482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5816 times since January 2019
Visitors: 4859