View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_high_28 (Length: 226)
Name: NF0769_high_28
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 14653167 - 14653284
Alignment:
| Q |
1 |
gggcaaaacaaaatgatgggaaagccaaacaaagtcatcaaacataactctttagaactcatcttcgtctcatctttctcgatcttcgtcttgctgcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14653167 |
gggcaaaacaaaatgatgggaaagccaaacaaagtcatcaaacataactctttagaactcatcttcgtctcatctttctcgatcttcgtcttgctgcaat |
14653266 |
T |
 |
| Q |
101 |
acaatattgtctaaagta |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14653267 |
acaatattgtctaaagta |
14653284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University