View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0769_high_29 (Length: 226)

Name: NF0769_high_29
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0769_high_29
NF0769_high_29
[»] chr8 (1 HSPs)
chr8 (1-118)||(14653167-14653284)


Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 14653167 - 14653284
Alignment:
1 gggcaaaacaaaatgatgggaaagccaaacaaagtcatcaaacataactctttagaactcatcttcgtctcatctttctcgatcttcgtcttgctgcaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14653167 gggcaaaacaaaatgatgggaaagccaaacaaagtcatcaaacataactctttagaactcatcttcgtctcatctttctcgatcttcgtcttgctgcaat 14653266  T
101 acaatattgtctaaagta 118  Q
    ||||||||||||||||||    
14653267 acaatattgtctaaagta 14653284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5456 times since January 2019
Visitors: 4854