View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0769_high_5 (Length: 416)

Name: NF0769_high_5
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0769_high_5
NF0769_high_5
[»] chr7 (1 HSPs)
chr7 (241-326)||(6071906-6071991)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 6e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 241 - 326
Target Start/End: Complemental strand, 6071991 - 6071906
Alignment:
241 ctctttctcaaggtttgaaaccctctcaaccaaaacctcacgatccaaatttccaccattttcaacacctttccccttcgaacctt 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6071991 ctctttctcaaggtttgaaaccctctcaaccaaaacctcacgatccaaatttccaccattttcaacacctttccccttcgaacctt 6071906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University