View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_15 (Length: 416)
Name: NF0769_low_15
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0769_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 6e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 241 - 326
Target Start/End: Complemental strand, 6071991 - 6071906
Alignment:
Q |
241 |
ctctttctcaaggtttgaaaccctctcaaccaaaacctcacgatccaaatttccaccattttcaacacctttccccttcgaacctt |
326 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6071991 |
ctctttctcaaggtttgaaaccctctcaaccaaaacctcacgatccaaatttccaccattttcaacacctttccccttcgaacctt |
6071906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University