View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_18 (Length: 394)
Name: NF0769_low_18
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0769_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 23 - 365
Target Start/End: Complemental strand, 50655037 - 50654700
Alignment:
Q |
23 |
atcatcaatcatatcccaatattcat--gactgagaaagatagaaatcaatatcttagnnnnnnnnnnnnnnnngttgagggaaaatcaatatcatagtg |
120 |
Q |
|
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
50655037 |
atcatcaatcatatcccaatattcatatgattgagaaagatagaaatcaatatcttagtttttttttt-------ttgagggaaaatcaatatcatagtg |
50654945 |
T |
 |
Q |
121 |
actgaatcattttgcaattcataagtaacattcattagtctttttagcatagtataagtttcctcacttgaactgattggtttgctctcaaatgatacaa |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
50654944 |
actgaatcattttgcaattcataagtaacattcattagtctttttagcatagtataattttcctcacttgaactaattggtttgctctcaaatgatacaa |
50654845 |
T |
 |
Q |
221 |
tcttcttaattacagattccaattttatgtggactaacagatccttagttcgggttaatggtttttgttgaactataggttttggattttatttggttgc |
320 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50654844 |
tcttcttaattacagattccaattttatgtggactaacagatccttagttcgggttattggtttttgttgaactataggttttggattttatttggttgc |
50654745 |
T |
 |
Q |
321 |
ataaattgttgtcttgaattcctgtttacccattatttgttatta |
365 |
Q |
|
|
||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
T |
50654744 |
ataaattgttgtcgtgaattcctgttcacccattatttgttatta |
50654700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University