View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_26 (Length: 334)
Name: NF0769_low_26
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13909235 - 13909187
Alignment:
| Q |
276 |
ttttgttacttggctttaagtcaaactccatattactaatgctttcatc |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13909235 |
ttttgttacttggctttaagtcaaactccatattattaatgctttcatc |
13909187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 13910599 - 13910553
Alignment:
| Q |
181 |
aaaatgtagttatagaatattagaatttttaataagaaaaatgtagt |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13910599 |
aaaatatagttatagaatattagaatttttaataagaaaaatgtagt |
13910553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 95 - 153
Target Start/End: Complemental strand, 13910686 - 13910626
Alignment:
| Q |
95 |
aataatgactacatgtgtgtgtg--ggagagtcatatattccaattgttttcgaagtgata |
153 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
13910686 |
aataatgactacatgtgtgtgtgtgggagagtgatatattccaattgttttctgagtgata |
13910626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University