View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0769_low_26 (Length: 334)

Name: NF0769_low_26
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0769_low_26
NF0769_low_26
[»] chr2 (3 HSPs)
chr2 (276-324)||(13909187-13909235)
chr2 (181-227)||(13910553-13910599)
chr2 (95-153)||(13910626-13910686)


Alignment Details
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 324
Target Start/End: Complemental strand, 13909235 - 13909187
Alignment:
276 ttttgttacttggctttaagtcaaactccatattactaatgctttcatc 324  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||    
13909235 ttttgttacttggctttaagtcaaactccatattattaatgctttcatc 13909187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 13910599 - 13910553
Alignment:
181 aaaatgtagttatagaatattagaatttttaataagaaaaatgtagt 227  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||    
13910599 aaaatatagttatagaatattagaatttttaataagaaaaatgtagt 13910553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 95 - 153
Target Start/End: Complemental strand, 13910686 - 13910626
Alignment:
95 aataatgactacatgtgtgtgtg--ggagagtcatatattccaattgttttcgaagtgata 153  Q
    |||||||||||||||||||||||  ||||||| |||||||||||||||||||  |||||||    
13910686 aataatgactacatgtgtgtgtgtgggagagtgatatattccaattgttttctgagtgata 13910626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University