View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_36 (Length: 286)
Name: NF0769_low_36
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0769_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 82 - 283
Target Start/End: Original strand, 41004616 - 41004817
Alignment:
Q |
82 |
ttcgcaccgtcgttgaaaacggtacctcacgtttcatctccttcgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
181 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41004616 |
ttcgcaccgtcgttgaaaacggtacctcacgtttcatctcctttgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
41004715 |
T |
 |
Q |
182 |
cgccgttaacgctgctaattatcaacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttcttcatctcact |
281 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41004716 |
cgccgttaacgctgctaattatcaacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttcttcatctcact |
41004815 |
T |
 |
Q |
282 |
cg |
283 |
Q |
|
|
|| |
|
|
T |
41004816 |
cg |
41004817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University