View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_38 (Length: 278)
Name: NF0769_low_38
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 33 - 250
Target Start/End: Complemental strand, 45318019 - 45317802
Alignment:
| Q |
33 |
agtgagatgaatgtgctggaattttggtttgaaatgtcccaaaaatttgagccaatcattatctcttgatggatcggctcaaatgcaagtttgaaccttt |
132 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45318019 |
agtgacatgaatgtgctggaattttggtttgaaatgtcccaaaaatttgagccaatcattatctcttgatggatcggctcaaatgcaagtttgaaccttt |
45317920 |
T |
|
| Q |
133 |
caaactgaaatctaaacatgcatgaaacatttggaagatgagaattaaaaaccagaacatagcaaaaatttcatctctattctcccnnnnnnnnttggtt |
232 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45317919 |
caaactgaaatctaaacatgcacgaaacatttggaagatgagaattaaaaaccagaacatagcaaaaatttcatctctattctcccaaaaaaaattggtt |
45317820 |
T |
|
| Q |
233 |
cctttcatggagcaccac |
250 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45317819 |
cctttcatggagcaccac |
45317802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5917 times since January 2019
Visitors: 4860