View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_39 (Length: 276)
Name: NF0769_low_39
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 25356352 - 25356494
Alignment:
| Q |
1 |
tgcttatttttgtgtccaaaagatttaggatatttacaattttgataattaaatcaaaacatgtattatttttcgtacctgtcaattatttacttgaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25356352 |
tgcttatttttgtgtccaaaagatttaggatattcacaattttgacaattgaatcaaaacatgtattatttttagtacctgtcaattatttacttgaaat |
25356451 |
T |
|
| Q |
101 |
aaccattttgttgtgatgccaatcaaaggtggaaattggctgc |
143 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25356452 |
atccattttgttgtgatgccaatcaaaggtgaaaattggctgc |
25356494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 25356414 - 25356464
Alignment:
| Q |
214 |
gtattatttttcgtacccgtcaattatttacttgaaatatccatattgttg |
264 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
25356414 |
gtattatttttagtacctgtcaattatttacttgaaatatccattttgttg |
25356464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4273 times since January 2019
Visitors: 4832