View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_40 (Length: 271)
Name: NF0769_low_40
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 36 - 248
Target Start/End: Original strand, 44130298 - 44130508
Alignment:
| Q |
36 |
gttgggtgaggtcgtagttgaaatgctgaagaaaaatccaaggaagttcgtgccatcatcatcatcatctctctctctgagaaagagaaagagactagct |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130298 |
gttgggtgaggtcgtagttgaaatgctgaagaaaaatccaaggaagttcgtgccatcatcatcatcatctctctctctgagaaagagaaagagactagct |
44130397 |
T |
 |
| Q |
136 |
agtaattgatagctctatnnnnnnnnnnnnnnnnccctttttctattgtgggatcgaagaatgaatgaattatcatgaaaactgtggtgtctactttttt |
235 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130398 |
agtaattgatagctctat--tctctctctctctcccccttttctattgtgggatcgaagaatgaatgaattatcatgaaaactgtggtgtctactttttt |
44130495 |
T |
 |
| Q |
236 |
atgccctccacat |
248 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44130496 |
atgccctccacat |
44130508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University